linuxmemes linuxmemes Guess how I spent my morning...
Jump
  • Mininux Mininux 2 months ago 100%

    sound's like timeshift's fault, not btrfs

    4
  • technology Technology Microsoft Will Charge for Windows 10 Security Updates in 2025
    Jump
  • Mininux Mininux 10 months ago 80%

    Yeah, but there is almost never a need for keeping an older version of linux, unlike for Windows 10 since win11 has ridiculous system requirements

    3
  • linux Linux Question: is systemd-homed ready for everyday use yet?
    Jump
  • Mininux Mininux 12 months ago 100%

    Never used systemd-homed, but i know an alternative to full disk encryption is having the root partition unencrypted, and the home partition unlocked at boot. For a single user machine at least, i don't see any difference when using it than unlocking at login. But then having 2 partitions is mandatory, and that may be a problem when running out of space.

    11
  • futurology Futurology Google's search results are starting to become contaminated with SEO optimized AI-hallucinated fake information.
    Jump
  • Mininux Mininux 12 months ago 100%

    today's search results are horrible, there are ai generated articles that just happen to contain your question but barely answer it, and also websites that copy stackoverflow and others content (and eventually translate it VERY badly)

    12
  • android Android Exclusive: Google Pixel 9 processor won't be the ambitious chip we hoped for
    Jump
  • Mininux Mininux 1 year ago 94%

    not any phone. And you have to rely on someone to maintain the build. And hope that it's stable. And the manufacter has to allow unlocking bootloader without sacrificing a goat.

    16
  • pics pics The Veluwemeer Aqueduct: Netherland's Unique Water Bridge
    Jump
  • Mininux Mininux 1 year ago 100%

    my brain took way too long to understand the picture

    33
  • linuxmemes linuxmemes The Design is Very Human
    Jump
  • Mininux Mininux 1 year ago 83%

    it's mostly for touchpads, I find it better as it mimics the behaviour on phones touchscreen but sometimes I disable it

    I hope nobody uses it on a mouse

    8
  • gameart Video Game Art "SPEEDRUN" by BEEPLE
    Jump
  • Mininux Mininux 1 year ago 100%

    Super Mario Wonder

    Wonder how powerful that drug must have been

    6
  • memes Memes unholy software..
    Jump
  • Mininux Mininux 1 year ago 95%

    huh every time I plug my Logitech receiver in a different port I get a notification about a driver installation, fortunately it's almost instant on my new pc but it's still weird that we need that in 2023

    18
  • memes Memes They say use whatsapp, they say use zoom
    Jump
  • Mininux Mininux 1 year ago 100%

    ah too bad, I had looked up about the WhatsApp bridge thing but was too lazy to setup the bridge, I was hoping there would be Publix bridges (although bad for privacy)

    Guess I'll have to threaten convince my friends to use matrix

    2
  • memes Memes They say use whatsapp, they say use zoom
    Jump
  • Mininux Mininux 1 year ago 100%

    But you have to setup a custom synapse bridge for element right ? Or did you find public servers ?

    5
  • france France [Carte] Mr. Freeze ou Yéti?
    Jump
  • Mininux Mininux 1 year ago 100%

    "hier mon yéti a fondu"

    phrase maudite

    6
  • rance Rance Pas contents !
    Jump
  • Mininux Mininux 1 year ago 100%

    Pas de soucis Alt Grrrr, je touche pas

    je préfère ctrl+alt de toute façon

    1
  • Mininux Mininux 1 year ago 100%

    Why doesn't the brain just enable ray tracing ? Is it stupid ?

    edit: bruh I just read your next comment and you have already kinda made the joke

    1
  • technology Technology Firefox to become first mobile browser to support desktop extensions later this year
    Jump
  • Mininux Mininux 1 year ago 100%

    oh I didn't know, pretty cool

    at least both chromium and Firefox get a version with add ons

    3
  • technology Technology Firefox to become first mobile browser to support desktop extensions later this year
    Jump
  • Mininux Mininux 1 year ago 98%

    Doesn't it already support them ?

    edit: yes it already supports them, but it seems that now there will be more focus on mobile

    edit2: also they forgot about kiwi, but then it's not a major browser (and is it still maintained ?). still would've been cool if they corrected this

    70
  • fediverse Fediverse Why do comment counts often disagree with what I see?
    Jump
  • Mininux Mininux 1 year ago 99%

    There is the same problem on reddit, so they brought it here too so new users won't be disoriented (/s)

    119
  • linux Linux FYI LibreOffice Draw allows you to open, edit and digitally sign PDF files
    Jump
  • Mininux Mininux 1 year ago 100%

    But can it edit text fields ? like not drawing over them but changing the actual text stored

    2
  • memes Memes Always at the worst times too
    Jump
  • Mininux Mininux 1 year ago 100%

    Neat now I will remember this meme and laugh whenever I'm supposed to stay serious

    7
  • linux Linux *Permanently Deleted*
    Jump
  • Mininux Mininux 1 year ago 100%

    For Firefox I replaced it with the flatpak version and hid the system version, I found that better

    As for chosing what to install where, i made simple rules

    • If it's available as a flatpak, I use the flatpak
    • Otherwise if it is system related/always required, rpm-ostree
    • Otherwise, I use distrobox (it's like toolbx but better, it's more integrated with the rest of the system and allows to have containers of other distros, for example I had some debian only packages and used an Arch container for AUR packages)

    But if it's too much of a hassle for and it's gonna be your daily system, yeah better not use it.

    4
  • linux Linux *Permanently Deleted*
    Jump
  • Mininux Mininux 1 year ago 100%

    If I change a config file in /etc, will the changes survive a reboot?

    I didn't completely understand how etc is handled, but it worked fine and kept my configs while merging at the same time the files from the apps i installed

    How can I see or decide which parts of the system are immutable and which are not?

    I'm note sure it's possible, at least i didn't see the option and i've never tried (i never needed it anyway). /var was mutable, /usr/lib /usr/bin... were not (/usr/local was mutable), and /opt and /home were symlinked to /var/opt and /var/home, so mutable

    edit: now i remember there was something about using "overlays" that allowed to modify /usr, i think i only used it once so i don't really remember

    Can I install packages that aren’t available as flatpaks, like more obscure stuff or command line tools?

    Yes, thanks to rpm-ostree, you can install basically any rpm with it, it's just really slow as each transaction must create a new generation, but it worked fine. Also you are supposed to reboot to make the changes apply, unless you use the --apply-live option (which was described as experimental when i was using it, don't now about now tho)

    What about ppd files for printing, firmware, drivers, fonts, icon packs, etc.? Where and how do those get installed?

    Same thing, rpm-ostree

    5
  • memes Memes *Permanently Deleted*
    Jump
  • Mininux Mininux 1 year ago 6%

    😂😂😂

    -71
  • linux_gaming Linux Gaming PSA for people trying out Wine/Proton for the first time
    Jump
  • Mininux Mininux 1 year ago 100%

    I read on the github that there is a registry key to set to fix this problem

    1
  • linux_gaming Linux Gaming PSA for people trying out Wine/Proton for the first time
    Jump
  • Mininux Mininux 1 year ago 100%

    Did you symlink the compdqta folder um don't remember it's been too long..

    Also I heard winbtrfs in windows isn't as stable as ntfs3 in Linux :(

    I'm trying to share stuff between the os because I lack so much space (500 Go for Windows + nixos + my old fedora silverblue parution that still has data I have to clean) fortunately I'm soon upgrading to 1To but I'll probably fill everything again in a fews months 😅

    2
  • linux_gaming Linux Gaming PSA for people trying out Wine/Proton for the first time
    Jump
  • Mininux Mininux 1 year ago 100%

    ah too bad, I thought I finally had a solution for the lack of storage.. I'll probably do it anyway just in case I need quick access to one Linux game but the rest of the time I'll keep them on the ntfs

    2
  • linux_gaming Linux Gaming PSA for people trying out Wine/Proton for the first time
    Jump
  • Mininux Mininux 1 year ago 100%

    Ah I wish I read that sooner, when the ntfs3 driver was released I moved my games to an NTFS partition, i don't remember precisely but some wouldn't work, and then unlike my ext4 or btrfs partition which were unbreakable, a lot of things became unreadable and undeletable after a forced shutdown. Probably my fault, but in any case i think it's not worth the hassle. I only had games on it fortunately so didn't lose anything significant

    ...and now I'm planning on making a btrfs partition for my games and using winbtrfs to use it on windows as well, probably another bad idea but I wanna do it so badlybadly

    EDIT: Yup, it was a bad idea, sometimes getting blue screens when trying to empty the trash on the btrfs

    4
  • piracy Piracy: ꜱᴀɪʟ ᴛʜᴇ ʜɪɢʜ ꜱᴇᴀꜱ Anyone who downloaded the GOG Baldur's Gate 3 release from 1337x, scan with Malwarebytes asap!
    Jump
  • Mininux Mininux 1 year ago 100%

    It doesn't matter, inux does not rely on extensions, so you can name a Linux executable .exe .bin or anything. When I was learning ocaml that's what our teacher was naming his executables.

    but plz don't do it it's cursed and I hate it, thank you

    2
  • mildlyinfuriating Mildly Infuriating *Permanently Deleted*
    Jump
  • Mininux Mininux 1 year ago 100%

    Insecurity is annoying too 🤷‍♂️

    3
  • mildlyinfuriating Mildly Infuriating *Permanently Deleted*
    Jump
  • Mininux Mininux 1 year ago 98%

    I hate windows too but this is something normal that also happens on Linux. Take a drive from another system and you won't be able to edit its protected files without root access.

    67
  • technology Technology An Asian MIT student asked AI to turn an image of her into a professional headshot. It made her white with lighter skin and blue eyes.
    Jump
  • Mininux Mininux 1 year ago 100%

    If you can code it, it isn't really AI

    thx I'm gonna use that sentence so much now, I'm so tired of hearing people calling themselves AI experts when they merely do regular programing, like yes your program is pretty cool, but no it's not AI.

    "but... but it reacts to its environment, it's intelligent" NO BECAUSE THEN LITERALLY EVERYTHING WOULD BE "INTELLIGENT" and the word AI would be useless, as we have been doing that for decades with if/else

    sory im angery

    1
  • memes Memes AACGTCATAGCCTGATTACCAGTAGGTACTAG
    Jump
  • Mininux Mininux 1 year ago 100%

    Oh cool I didn't know that stuff, it's super interesting

    1
  • memes Memes AACGTCATAGCCTGATTACCAGTAGGTACTAG
    Jump
  • Mininux Mininux 1 year ago 100%

    If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences

    Wikipedia: Human genome#Information content

    10
  • memes Memes My sister called this the plant that smells like bubble gum as a kid
    Jump
  • Mininux Mininux 1 year ago 94%

    Shrödinger's extinction

    30
  • technology Technology The state of Playstore
    Jump
  • Mininux Mininux 1 year ago 100%

    Try neo store, it's pretty cool

    3
  • youshouldknow You Should Know YSK: Your Lemmy activities (e.g. downvotes) are far from private
    Jump
  • Mininux Mininux 1 year ago 100%

    It's probably bad for privacy, but it makes self hosting super easy

    1
  • nostupidquestions No Stupid Questions Is jellyfish vegan?
    Jump
  • Mininux Mininux 1 year ago 100%

    moral of the story: if you have an addiction, replace it with tomatoes

    1
  • europe Europe EU wants over 70s to prove they can still drive every five years
    Jump
  • Mininux Mininux 1 year ago 100%

    that's true, a lot of people probably KNOW how to drive safely (according to their license's definition) but just don't care

    About the black box thing, that may actually be a good idea, but hard to execute

    1
  • nostupidquestions No Stupid Questions Is jellyfish vegan?
    Jump
  • Mininux Mininux 1 year ago 100%

    That actually makes a lot of sense, i'll probably steal some of your points for future debates :)

    1
  • nostupidquestions No Stupid Questions Is jellyfish vegan?
    Jump
  • Mininux Mininux 1 year ago 100%

    oh it makes more sense with this definition instead of just "living beings"

    3
  • nostupidquestions No Stupid Questions Is jellyfish vegan?
    Jump
  • Mininux Mininux 1 year ago 100%

    If having a reaction to physical damage (like moving away) is enough to be qualified as pain, then some plants feel pain too. We studied in biology a plant that when cut/eaten by animals releases chemicals that warn plants around it and triggers them to release another chemical that interferes with animal's digestive system and make them starve (I don't remember the name of the plant unfortunately). So should we consider this as pain too ?

    there are many other examples here too:wikipedia

    man I hate philosophy

    4
  • "Initials" by "Florian Körner", licensed under "CC0 1.0". / Remix of the original. - Created with dicebear.comInitialsFlorian Körnerhttps://github.com/dicebear/dicebearBU
    Build a PC Mininux 1 year ago 75%
    90A duet rail or 75A direct VRM for 13700K (maybe overclocking) ?

    Hi, i plan on building a pc soon using an i7 13700K and i hesitate between the MSI Z790 tomahawk and Z690 force. There is like a 10€ difference of price between them (in france) so not significant. The Z790 Tomahawk has a 16 duet rails power system, i don't really understand what it means but i saw the z690 force has a *direct* 18 phases power system, which i think is better from what i read ? However they say the tomahawk has a 90 A VRM while the force has 75 A. So i'm wondering what is the most important for a potential overclock, direct phase or total current ? (i could also be completing mixing things up and misunderstood the descriptions) Also the z690 force has a true debug display with digits, so that's interesting, but the z790 tomahawk has more 3.2 usb ports and one more usb-c port... Thx in advance

    2
    0